|
| FASTA Files |
Step One in Aligning Your Report:
1. Use the "Browse" option to
search for the FASTA file that you would like to have aligned.
2. Leave the default '5' in
the box for "Batch
Size for NAST".
All this step does is tell Greengenes to
report back to you when five
sequences have been aligned. If you submit 20 sequences, it will
give your four status updates while it aligns the sequences. You
can
set this at a higher or lower number, however if you set it much higher
you will have that feeling that your computer is thinking without doing
anything. By leaving it at '5', you get regular feedback from
the
server. Unless you have a very large number of sequences
(>75), you
should leave the
batch size at 5. To do high throughput analysis
you will want to increase the batch size to speed things up a bit.
3. Click here to move
to the next step in alignment.
What is a FASTA file?
The FASTA file is a simple text file returned
either
directly from the sequencing lab or from a program like FinchTV or
Phred. A FASTA file represents the change from a chromatogram
to an
actual list of bases indicated by the individual peaks in the
chromatogram. It consists of a greater-than sign (>) followed by a unique ID for each
sequence, then followed
by the corresponding nucleotide bases. Note: There cannot be a space between the > and the ID. You will run into problems with your FASTA if there is a space here.
Sample Chromatogram
 
Sample FASTA file
>559036A1_A01_420799_A1_015
TIME: Fri Mar
4 09:42:15 2005
gggggcgcggtctagcatgcaagtcgagcggcagcggtagcaatatcgcctagancggcggactggtgagtaacacgtgggrratctacctttgggatggggatagcctgtggaaacacaggataataccgaatacgttgactggattac
ggtccagccaggaaaggtccgtttggaccgcccgaagatgagcccgcggctgattagctagttxgcggggtaatggcccaccaagycgatgatcagtaggcgnnntgagagggtgtacgcccacattgggactgagatacggcccaa
How
to get a FASTA file
Sample
Data (FASTA) Set
Tutorial
Main
Greengenes
Main |
|
